View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9272_high_2 (Length: 370)
Name: NF9272_high_2
Description: NF9272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9272_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 57; Significance: 1e-23; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 91 - 215
Target Start/End: Complemental strand, 2800591 - 2800467
Alignment:
| Q |
91 |
cgttgatgttacgtacctgcagattctgtcatcaatacaaatctgtataagttgagaactgacaatacctgcaggttgtaaacataatgctatgaattaa |
190 |
Q |
| |
|
|||||||||| | |||||| |||||||||||| | |||||||||||||| ||||||| |||||| |||||||||||||||||| |||||||| | || |
|
|
| T |
2800591 |
cgttgatgttgcatacctgtagattctgtcattattacaaatctgtataggttgagagctgacagcacctgcaggttgtaaacagaatgctattacctac |
2800492 |
T |
|
| Q |
191 |
attcttttcaaatcagtgcataacc |
215 |
Q |
| |
|
| ||||||||| |||||||||||| |
|
|
| T |
2800491 |
agccttttcaaaacagtgcataacc |
2800467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 323 - 360
Target Start/End: Original strand, 2401812 - 2401849
Alignment:
| Q |
323 |
aacaaacagtgctaagtaaacattgaaataaataaaca |
360 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2401812 |
aacaaacggtgctaagtaaacattgaaataaataaaca |
2401849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 92 - 215
Target Start/End: Complemental strand, 4249913 - 4249790
Alignment:
| Q |
92 |
gttgatgttacgtacctgcagattctgtcatcaatacaaatctgtataagttgagaactgacaatacctgcaggttgtaaacataatgctatgaattaaa |
191 |
Q |
| |
|
||||||||| | |||||| |||||||||||| | |||||||||||||| ||||||| |||||| |||||||||||||||||| |||||||| | || | |
|
|
| T |
4249913 |
gttgatgttgcatacctgtagattctgtcattattacaaatctgtataggttgagagctgacagcacctgcaggttgtaaacagaatgctattacctaca |
4249814 |
T |
|
| Q |
192 |
ttcttttcaaatcagtgcataacc |
215 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
4249813 |
gccttttcaaaacagtgcataacc |
4249790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University