View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9273_low_3 (Length: 413)
Name: NF9273_low_3
Description: NF9273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9273_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 336 - 397
Target Start/End: Original strand, 12190210 - 12190271
Alignment:
| Q |
336 |
acttgaatatataacaaaaataaatcattcatttgtctgttcaattctactatggagtattt |
397 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12190210 |
acttgaatatataacaaaaataaattattcatttgtctgttcaattctactatggagtattt |
12190271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University