View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9275_low_3 (Length: 274)
Name: NF9275_low_3
Description: NF9275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9275_low_3 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 14 - 274
Target Start/End: Original strand, 36461618 - 36461878
Alignment:
| Q |
14 |
attattctggacagagtagtgtattattagtccttgcaaccatgctagcaagtaaattaagacattcccnnnnnnnngttgaagtacaatgttttagttt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36461618 |
attattctggacagagtagtgtattattagtccttgcaaccatgctagcaagtaaattaagacattcccaaaaaaaagttgaagtacaatgttttagttt |
36461717 |
T |
 |
| Q |
114 |
gcttttagaataaatatactaatactataaataaatgatgatatatttgtgtttaaatgttttttcctttattgaagtcgatattgttaggtttacatct |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36461718 |
gcttttagaataaatatactaatactataaataaatgatgatatatttgtgtttaaatgtttttttctttattgaagtcgatattgttaggtttacatct |
36461817 |
T |
 |
| Q |
214 |
ttacttaggttcaaatttaaaatttaacaaatgcgtgtatgaattttaggtggtgtttgtc |
274 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36461818 |
ttacttaagttcaaatttaaaatttaacaaatgcgtgtatgaattttaggtggtgtttgtc |
36461878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University