View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9275_low_8 (Length: 205)
Name: NF9275_low_8
Description: NF9275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9275_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 16 - 189
Target Start/End: Complemental strand, 3800381 - 3800208
Alignment:
| Q |
16 |
tctccaaaattatttaaagtttgcatctcttgcaccatattatcaaataagatcttatctacaccacgccatgggatgtttgttgtgtccatcataggta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3800381 |
tctccaaaattatttaaagtttgcatctcttgcaccatattatcaaataagatcttatctacgccacgccatgggatgtttgttgtgtccatcataggta |
3800282 |
T |
 |
| Q |
116 |
tatccggggagatttgaatttcttgttttttggttggatttcctgcaatgccaaaacgagatcatggaatattt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3800281 |
tatccggggagatttgaatttcttgttttttggttggatttcctgcaatgccaaaacgagatcatgaaatattt |
3800208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 27 - 181
Target Start/End: Original strand, 3789734 - 3789888
Alignment:
| Q |
27 |
atttaaagtttgcatctcttgcaccatattatcaaataagatcttatctacaccacgccatgggatgtttgttgtgtccatcataggtatatccggggag |
126 |
Q |
| |
|
||||| |||||| ||||||||||| | || |||||| |||||||||||||| || |||||||||| ||||||||||| ||||||||||||||| |||||| |
|
|
| T |
3789734 |
atttatagtttgtatctcttgcacaaaatgatcaaagaagatcttatctacgccgcgccatgggaagtttgttgtgttcatcataggtatatcaggggag |
3789833 |
T |
 |
| Q |
127 |
atttgaatttcttgttttttggttggatttcctgcaatgccaaaacgagatcatg |
181 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||| |||| ||||||||| |
|
|
| T |
3789834 |
atttgaatttcttgttttttggtgggatttcctacaatgcgaaaaggagatcatg |
3789888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University