View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9279_high_18 (Length: 270)
Name: NF9279_high_18
Description: NF9279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9279_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 22 - 252
Target Start/End: Original strand, 38013537 - 38013774
Alignment:
| Q |
22 |
aaacaatgcagtggtcgatgacatggacggttacctcaacaacctttccctcgaatacgaatctgtttgggacaccaaaccatcttggtatggttcatct |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38013537 |
aaacaatgcagtggtcgatgacatggacggttacctcaacaacctttccctcgaatacgaatctgtttgggacaccaaaccatcttggtatggttcatct |
38013636 |
T |
 |
| Q |
122 |
tcattccttaatcattttcttcaatttttagaactaaatttgatgta----------tttgttttaggtgtcagccatggacaattacgctaactggggt |
211 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38013637 |
tcattacttaatcatt---ttcaatttttagaactaaatttgatgtatttgtcatgttttgttttaggtgtcagccatggacaattacgctaactggggt |
38013733 |
T |
 |
| Q |
212 |
ttcaataatttccattagctggttaattttcaactctatct |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38013734 |
ttcaataatttccattagctggttaattttcaactctatct |
38013774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University