View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9279_low_21 (Length: 387)
Name: NF9279_low_21
Description: NF9279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9279_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 121 - 378
Target Start/End: Complemental strand, 23441377 - 23441120
Alignment:
| Q |
121 |
gcactccaggaggtattttttctaatttctataagctggatagtactgatataaatgataatcttattcctataaaccagggtttagaagatagttcagt |
220 |
Q |
| |
|
|||||| ||||| ||||||| |||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23441377 |
gcactctaggagatatttttcctaatttctataagctggatagtactaatataaatgataaacttattcctataaaccagggtttagaagatagttcagt |
23441278 |
T |
 |
| Q |
221 |
aactatttcataattccccattagtacatatgctgaataatattgcagttaccctatattaattgtgcaatttttattacgatactattgctaatgtcac |
320 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
23441277 |
aactatttcatatttccccattagtacatatgctgaataatattgcagttaccctatattaattgtgcaatttttataaccatactattgctaatgtcac |
23441178 |
T |
 |
| Q |
321 |
ttaattttttatgtgcagagcaatgaagtactgattcttttaatcatgccagaataat |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23441177 |
ttaattttttatgtgcagagcaatgaagtactgattcttttgatcatgccagaataat |
23441120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 245 - 297
Target Start/End: Original strand, 23887382 - 23887434
Alignment:
| Q |
245 |
tacatatgctgaataatattgcagttaccctatattaattgtgcaatttttat |
297 |
Q |
| |
|
|||||||| |||||||||||||||||| || | |||||||| |||||||||| |
|
|
| T |
23887382 |
tacatatgttgaataatattgcagttatactgttttaattgttcaatttttat |
23887434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University