View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9279_low_27 (Length: 356)
Name: NF9279_low_27
Description: NF9279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9279_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 1 - 340
Target Start/End: Original strand, 3158897 - 3159236
Alignment:
| Q |
1 |
cacttcatggtcttcacccgccagagaccaagatgttcagcgaacgcacaaattatacagagcttaatcagatggctgaagaagctaaaagacgagcgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3158897 |
cacttcatggtcttcacccgccagagaccaagatgttcagcgaacgcacaaattatacagagcttaatcagatggctgaagaagctaaaagacgagcgga |
3158996 |
T |
 |
| Q |
101 |
aattgcaaggtatacaagcatgctcccagaatctatgtataaattgtttccaaccaattttgcaatcatcattttctaaaacctttatatggcatatgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3158997 |
aattgcaaggtatacaagcatgctcccagaatctatgtataaattgtttccaaccaattttgcaatcatcattttctaaaacctttatatggcatatgga |
3159096 |
T |
 |
| Q |
201 |
tagtcaacttcattaagtgcttatttgtttctacgaccaaagagtgaataatggcttctaacctattttatcatctttgttgatttttgcagaattagag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3159097 |
tagtcaacttcattaagtgcttatttgtttctactaccaaagagtgaataatggcttctaacctattttatcatctttgttgatttttgcagaattagag |
3159196 |
T |
 |
| Q |
301 |
agttgcacacactcaagggccatgttgagtcagtggttag |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3159197 |
agttgcacacactcaagggccatgttgagtcagtggttag |
3159236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University