View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9280_low_4 (Length: 516)
Name: NF9280_low_4
Description: NF9280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9280_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 4e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 4e-70
Query Start/End: Original strand, 21 - 176
Target Start/End: Complemental strand, 11155909 - 11155752
Alignment:
| Q |
21 |
tttgcattgaggactgaactgttgaaccaaactgaact--gttcagttcgaggattctatcacaagaacatgcaatgcaatcaagtatgcaagaggatca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11155909 |
tttgcattgaggactgaactgttgaaccgaactgaactcagttcggttcgaggattctatcacaagaacacgcaatgcaatcaagtatgcaagaggatca |
11155810 |
T |
 |
| Q |
119 |
gcttcaagattggcaaggttcaagggatgtgttgacaatagagacttcatttccttag |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11155809 |
gcttcaagattggcaaggttcaagggatgtgttgacaatagagacttcatttccttag |
11155752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University