View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9281_high_11 (Length: 249)
Name: NF9281_high_11
Description: NF9281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9281_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 22 - 235
Target Start/End: Complemental strand, 47579039 - 47578826
Alignment:
| Q |
22 |
caggtaattgctctttagctgggtgtgctactggtagttgttcttgttttgcatctttggaccgtgatttcttgttgttgttgccgccatcaccgccacc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| || |
|
|
| T |
47579039 |
caggtaattgctctttagctgggtgtgctactggtagttgttcttgttttgcatctttggactgtgattttttgttgttgttgccgccatcaccgccgcc |
47578940 |
T |
 |
| Q |
122 |
cccagcattatttccatttccaccatctccaccttcattttgagccatatgttgcagataaacaaggaatgttatcaagtggaaactgctgtttagtttc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47578939 |
accagcattatttccatttccaccatctccaccttcattttgagccatatgttgcagataaacaaggaatgctatcaagtggaaactgctgtttagtttc |
47578840 |
T |
 |
| Q |
222 |
ttttgaaaaaactg |
235 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
47578839 |
ttttgaaaaaactg |
47578826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University