View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9281_high_13 (Length: 226)
Name: NF9281_high_13
Description: NF9281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9281_high_13 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 96 - 226
Target Start/End: Original strand, 35889439 - 35889565
Alignment:
| Q |
96 |
cttacataactttggtattatatttaaggatannnnnnnnnaatgatcttataattaaagataaagggagtatattattacttgagtcgcttagctattt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35889439 |
cttacataactttggtattatatttaaggatattttttt--aatgatcttataattaaagataaagggagtatattattacttgagtcgcttagctattt |
35889536 |
T |
|
| Q |
196 |
ggtgaatagatatctttggttgatgtgtatg |
226 |
Q |
| |
|
||| ||||| |||| ||||||||||||||| |
|
|
| T |
35889537 |
ggtcaatagctatc--tggttgatgtgtatg |
35889565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University