View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9281_low_19 (Length: 353)
Name: NF9281_low_19
Description: NF9281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9281_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 19 - 341
Target Start/End: Original strand, 46795063 - 46795391
Alignment:
| Q |
19 |
acccatgcaataaacgctcgatcagattgaacaacacaaacgaaaaaaccctcttccgtctctcaagtctcaacttcctttcatccattcatattatttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46795063 |
acccatgcaataaacgctcgatcagattgaacaacacaaacgaaaaaaccctcttccgtctctcaagtctcaacttcctttcatccattcatattatttt |
46795162 |
T |
 |
| Q |
119 |
cgtggtgagttcgtagttataatttcgttcttaccttttcatggcttcttttgattggttcagtaatttatgttttctggatttcaaatcaatcaatcaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46795163 |
cgtggtgagttcgtagttataatttcgttcttaccttttcatggcttcttttgattggttcagtaatttatgttttctggatttcaaatcaatcaatcaa |
46795262 |
T |
 |
| Q |
219 |
tttatgttttctgtaattttgtgtctttcgttttaccctgacca------caaccccaaccccaacccttgttttgttactggaaaatggaaagctgatg |
312 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46795263 |
tttatgttttctgtaattttatgtcttttgttttaccctgaccacaaccccaaccccaaccccaacccttgttttgttattggaaaatggaaagctgatg |
46795362 |
T |
 |
| Q |
313 |
atagaagaaatttaggcattgtgatttgt |
341 |
Q |
| |
|
|||||||||||||||| |||||||||||| |
|
|
| T |
46795363 |
atagaagaaatttaggtattgtgatttgt |
46795391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University