View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9281_low_21 (Length: 329)
Name: NF9281_low_21
Description: NF9281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9281_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 22 - 312
Target Start/End: Original strand, 35568158 - 35568448
Alignment:
| Q |
22 |
cgaatggtatgccaaaaacaacagggtaactttcaattaaaaggaggacacttgaaaaatcaatcatgttcatagcaatcaaacaaattatactcttatt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35568158 |
cgaatggtatgccaaaaacaacagggtaactttcaattaaaaggaggacacttgaaaaatcaatcatgttcatagcaatcaaacaaattatactcttatt |
35568257 |
T |
 |
| Q |
122 |
gaaaggctaaataggtagcattattactaacttttatcacatatcagaattctttttgtttcatnnnnnnnnntagcatcaatgtgccacactagatttg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35568258 |
gaaaggctaaataggtagcattattactaacttttatcacatatcagaattctttttgtttcataaaaaaaaatagcatcaatgtgccacactagatttg |
35568357 |
T |
 |
| Q |
222 |
tagtaaaataacagtgtcgtagcagcatttacagagcttgcagttggtttatgtcgttatagcttaagtctacaatacactaccccaaagt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35568358 |
tagtaaaataacagtgtcgtagcagcatttacagagcttgcagttggtttatgtcgttatagcttaagtctacactacactaccccaaagt |
35568448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University