View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9281_low_24 (Length: 311)
Name: NF9281_low_24
Description: NF9281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9281_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 16 - 300
Target Start/End: Complemental strand, 37848833 - 37848548
Alignment:
| Q |
16 |
tgactggtgaaggtcaaagtaatgattggcaaaggttgaagtggtggttggcgatggttggagtgatggttagtggaagttgaagtggtgtttaatagta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
37848833 |
tgactggtgaaggtcaaagtaatgattggcaaaggttgaagtggtggttggcgatggttggagtgatggttagtggaagtcgaagtggtggttaatagta |
37848734 |
T |
 |
| Q |
116 |
g-caaagtggtaatcaacggtggttggtgtgataatcgacggtggtcaggtggatgatcaaatgttgataaagtggtgattgatgatggagagattggag |
214 |
Q |
| |
|
| ||||||||||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| ||||||||||||| ||||||| | |
|
|
| T |
37848733 |
gtcaaagtggtaatcaatggtggttggtgtgataatcgatggtggtcaagtggatgatcaaatgttgataaagtggggattgatgatggacagattggtg |
37848634 |
T |
 |
| Q |
215 |
attgaaatggttgtcatattggtagttcttttttgtcaagtattataccgtttttaacatacacagcaaaacaaattgtgatgtcc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37848633 |
gttgaaatggttgtcatattggtagttcttttttgtcaagtattataccgtttttaacatacacaccaaaacaaattgtgatgtcc |
37848548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University