View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9281_low_28 (Length: 267)
Name: NF9281_low_28
Description: NF9281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9281_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 25245452 - 25245698
Alignment:
| Q |
1 |
accacatatcattatttttgtatgatcttatgtaaggtccatacaatatttcgatggaccttatttaaagagtcacttgaaacatatcttcgattgaacc |
100 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||| ||||||| |||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25245452 |
accacatgtcattatttttgtatgatcctatgtaagatccataccatatctcgatggaccttatttaaagagtcacttgaaacatatctttgattgaacc |
25245551 |
T |
 |
| Q |
101 |
tgacccgaaagattttaattttggtattgnnnnnnntcaaaatttgtattactaaatgaatcgtttcaatttcatctatgttcactatgttaacacgagg |
200 |
Q |
| |
|
| |||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25245552 |
cg-cccgaacgattttaattttggtattgaaaaaaatcaaaatttgtattactaaatgaatcgtttcaatttcatctatgttcactgtgttaacacgagg |
25245650 |
T |
 |
| Q |
201 |
actaccgacttcaagaaatccaaattctcttgttagattggccatgat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25245651 |
actaccgacttcaagaaatccaaattctcttgttagattggccatgat |
25245698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University