View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9281_low_29 (Length: 249)

Name: NF9281_low_29
Description: NF9281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9281_low_29
NF9281_low_29
[»] chr3 (1 HSPs)
chr3 (22-235)||(47578826-47579039)


Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 22 - 235
Target Start/End: Complemental strand, 47579039 - 47578826
Alignment:
22 caggtaattgctctttagctgggtgtgctactggtagttgttcttgttttgcatctttggaccgtgatttcttgttgttgttgccgccatcaccgccacc 121  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| ||    
47579039 caggtaattgctctttagctgggtgtgctactggtagttgttcttgttttgcatctttggactgtgattttttgttgttgttgccgccatcaccgccgcc 47578940  T
122 cccagcattatttccatttccaccatctccaccttcattttgagccatatgttgcagataaacaaggaatgttatcaagtggaaactgctgtttagtttc 221  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
47578939 accagcattatttccatttccaccatctccaccttcattttgagccatatgttgcagataaacaaggaatgctatcaagtggaaactgctgtttagtttc 47578840  T
222 ttttgaaaaaactg 235  Q
    ||||||||||||||    
47578839 ttttgaaaaaactg 47578826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University