View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9282_high_27 (Length: 239)
Name: NF9282_high_27
Description: NF9282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9282_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 25690967 - 25690742
Alignment:
| Q |
1 |
gactcatcctcaaaacttagtaaaagtcctttgcactcggcggagtctgctccgccgagtggaaagtatttttcagcgtattgttttgggataacaagac |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25690967 |
gactcatcttcaaaacttagtaaaagtcctttgcactcggcggagtctgctccgccgagtggaaagtatttttcagcgtattgttttgggataacaagac |
25690868 |
T |
 |
| Q |
101 |
ggttgagttttcctacgtcggaaggtgttaagggtttctcaaacattgattctttttcgtcttcgggttttacga---gggtggtggtgtctaattcttc |
197 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
25690867 |
ggttgagttttcctacgtcagaaggagttaagggtttctcaaacattgattctttttcgtcttcgggttctacgacggtggtggtggtgtctaattcttc |
25690768 |
T |
 |
| Q |
198 |
atcttctatgtttttgaggttgtaat |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
25690767 |
atcttctatgtttttgaggttgtaat |
25690742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University