View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9282_low_38 (Length: 367)
Name: NF9282_low_38
Description: NF9282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9282_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 11 - 349
Target Start/End: Complemental strand, 44049597 - 44049259
Alignment:
| Q |
11 |
agcacagacagaagaggtttgtgaagtactaggaaactcacaaaaactagtacatgaaattgttcaagttgtttttaacaaaaactatgataaagtttct |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44049597 |
agcacaaacagaagaggtttgtgaagtactaggaaattcacaaaaactagtacatgaaattgttcaagttgtttttaacaaaaactatgataaagtttct |
44049498 |
T |
|
| Q |
111 |
gaggctgcaattaaggccttatcagcattatgttcattggaatcaaacaaagagagtctagtgaaaggaggagcaataaatggaatcataacatatattt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44049497 |
gaggctgcaattaaggccttatcagcattatgttcattggaatcaaacaaagagagtctagtgaaaggaggagcaataaatggaatcataacatatattt |
44049398 |
T |
|
| Q |
211 |
caagatgtgaaaatagacagaagaatttggctccactagcaatggcaacaatgaagaaacttttggtgttagagagtggtaaagaggcattggtgaatca |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44049397 |
caagatgtgaaaatagacagaagaatttggctccactagcaatggcaacaatgaagaaacttttggtgttagagagtggtaaagaggcattggtgaatca |
44049298 |
T |
|
| Q |
311 |
tgtaaatggtattgaaactttggtgaagatggttttcaa |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44049297 |
tgtaaatggtattgaaactttggtgaagatggttttcaa |
44049259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University