View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9282_low_41 (Length: 348)
Name: NF9282_low_41
Description: NF9282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9282_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 14 - 134
Target Start/End: Original strand, 35674613 - 35674733
Alignment:
| Q |
14 |
ctttctttatgcagctagtatgccatgtcgccataaacaaccacataagtggtctttgacggaattagatagcggcaatttaagactnnnnnnnctccag |
113 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || | | |
|
|
| T |
35674613 |
ctttctttacgcagctagcatgccatgtcgccataaacaaccacataagtggtctttgacggaattagatagcggcaatttaaaactaaaaaaacttcgg |
35674712 |
T |
 |
| Q |
114 |
ttgtaatgtgcttgattgtaa |
134 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
35674713 |
ttgtaatgtgcttgattgtaa |
35674733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 301 - 335
Target Start/End: Original strand, 35655009 - 35655043
Alignment:
| Q |
301 |
atgtgacctttcacattttgatcaacaatcactct |
335 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35655009 |
atgtgacctttcacattttaatcaacaatcactct |
35655043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 170 - 206
Target Start/End: Original strand, 8342747 - 8342783
Alignment:
| Q |
170 |
ttcaataccattaaagtttatcttgccttgttctgtt |
206 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
8342747 |
ttcaataccataaaagtttatcttgcgttgttctgtt |
8342783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University