View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9282_low_54 (Length: 297)
Name: NF9282_low_54
Description: NF9282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9282_low_54 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 16 - 280
Target Start/End: Complemental strand, 36429832 - 36429568
Alignment:
| Q |
16 |
agatccatagtcaaaacaacacaaatattcttttatataaggatgaaaatagggaaaattgtaacatagtactactacagagttttaagtgacaagtaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36429832 |
agatccatagtcaaaacaacacaaatattcttttatataaggatgaaaatagggaaaattgtaacatagtactactacagagttttaagtgacaagtaaa |
36429733 |
T |
|
| Q |
116 |
gtgaatgatcatacgtgtttgaacccttatacagtacattcgagtccccatagttccttgccatatttactcatatgattgttggctggagtggacgtta |
215 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
36429732 |
gtgaatgatcatatgtgtttgaacccttatatagtacattcgagtccccatagttccttgccatatttgctcagatgattgttggctggagtggacgtgg |
36429633 |
T |
|
| Q |
216 |
caaacgggtgtaagataaacggaggcacgtatctgagtcaatagcataatggcaatgtagttttt |
280 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36429632 |
caaacgagtgtaagataaacggaggcgcgtatctgagtcaatagcataatggcaatgtagttttt |
36429568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University