View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9282_low_63 (Length: 235)
Name: NF9282_low_63
Description: NF9282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9282_low_63 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 190
Target Start/End: Complemental strand, 41809761 - 41809588
Alignment:
| Q |
18 |
gaagcaagttgttgggatcttaggatcgattaaggttttggttcgttaatttccattgtcttt-gcactattcatgtgtatatgtaatgtgttattcgct |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
41809761 |
gaagcaagttgttgggatcttaggatcgattaaggttttggtttgttaatttccattgtcttttgcactattcatgtgtatatgtaatgtgttattccct |
41809662 |
T |
|
| Q |
117 |
ttcatatttactaggattgaccttaacatatggaaggaggatgtcacacctcatgatattgtgaacgtctaccg |
190 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |||| ||||||||||||| ||||||| |
|
|
| T |
41809661 |
ttcatatttactaggattgaccttaaaatatggaaggaggatgtcacgcctcgtgatattgtgaacttctaccg |
41809588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University