View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9282_low_68 (Length: 227)
Name: NF9282_low_68
Description: NF9282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9282_low_68 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 46 - 208
Target Start/End: Original strand, 15935689 - 15935851
Alignment:
| Q |
46 |
agtaattcgatttgtacgagggaaaaggaaagatagaacggctcccaaaggagcgaacatggtttgtaactccgcttcgaggatgcgatctgcttcgcct |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15935689 |
agtaattcgatttgtacgagggaaaaggaaagatagaacggctcccaaaggagcgaacatggtttgtaactccgcttcgaggatgcgatctgcttcgcct |
15935788 |
T |
|
| Q |
146 |
tcgttgaggttagaaagctttttgccgaggagctcgtataattcatcgtcggggagacgagat |
208 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15935789 |
tcggggaggttagaaagctttttgccgaggagctcgtataattcatcgtcggagagacgagat |
15935851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University