View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9283_high_10 (Length: 214)

Name: NF9283_high_10
Description: NF9283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9283_high_10
NF9283_high_10
[»] chr7 (2 HSPs)
chr7 (128-200)||(1801560-1801632)
chr7 (1-50)||(1801433-1801482)


Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 128 - 200
Target Start/End: Original strand, 1801560 - 1801632
Alignment:
128 aatggttacattgtgagtgtgaaaaataatatgcttttgtgatggagatatattgttacaatgtggttgaaac 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1801560 aatggttacattgtgagtgtgaaaaataatatgcttttgtgatggagatatattgttacaatgtggttgaaac 1801632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 1801433 - 1801482
Alignment:
1 tgtgaatgaagatgtcgagactagtttgaagaatttgattcaagcacttg 50  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
1801433 tgtgaatgaagatgtcgagactagtttgaagaatttgattcaagcacttg 1801482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University