View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9283_high_5 (Length: 343)
Name: NF9283_high_5
Description: NF9283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9283_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 18 - 325
Target Start/End: Complemental strand, 38484162 - 38483855
Alignment:
| Q |
18 |
gcacagatgagggaaacatataggttcatttcataaaacatacccaacgaaaaggttcaattctagaagcattgtttacagtacacatgaaaagttggcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38484162 |
gcacagatgagggaaacatataggttcatttcataaaacatacccaacgaaaaggttcaattctagaagcattgtttacagtacacatgaaaagttggcg |
38484063 |
T |
 |
| Q |
118 |
gttagcagcactgaaatcgataaagacagggagtgtcaattatacacaactaagaacttttgagaggggattgcaaagttccttatgacccaaataattc |
217 |
Q |
| |
|
|| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38484062 |
gtaagcagcactgaaatcgataaagacggggagtgtcaattatacacaactaagaacttttgagaggggattgcaaagttccttatgacccaaataattc |
38483963 |
T |
 |
| Q |
218 |
agttataaatatgccaacagcattgcattggttatgtccttgttgaggtattggcagatagctctctggcggtatgtaaacaaattaactctgaaaattg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38483962 |
agttataaatatgccaacagcattgcattggttatgtccttgttgaggtattagcagatagctctctggcagtatgtaaacaaattaactctgaaaattg |
38483863 |
T |
 |
| Q |
318 |
aaaatctt |
325 |
Q |
| |
|
|||||||| |
|
|
| T |
38483862 |
aaaatctt |
38483855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University