View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9283_low_25 (Length: 214)
Name: NF9283_low_25
Description: NF9283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9283_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 128 - 200
Target Start/End: Original strand, 1801560 - 1801632
Alignment:
| Q |
128 |
aatggttacattgtgagtgtgaaaaataatatgcttttgtgatggagatatattgttacaatgtggttgaaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1801560 |
aatggttacattgtgagtgtgaaaaataatatgcttttgtgatggagatatattgttacaatgtggttgaaac |
1801632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 1801433 - 1801482
Alignment:
| Q |
1 |
tgtgaatgaagatgtcgagactagtttgaagaatttgattcaagcacttg |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1801433 |
tgtgaatgaagatgtcgagactagtttgaagaatttgattcaagcacttg |
1801482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University