View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9283_low_4 (Length: 479)
Name: NF9283_low_4
Description: NF9283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9283_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 238 - 461
Target Start/End: Original strand, 47435702 - 47435925
Alignment:
| Q |
238 |
tgaagattcagattttaaccccatgagtttcggacttattccattggggaaaaccctaacgtattcagcttcatttagaatctcagtgtcattggtggaa |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47435702 |
tgaagattcagattttaaccccatgagtttcggacttattccattggggaaaaccctaacgtattcagcttcatttagaatctcagtgtcattggtggaa |
47435801 |
T |
 |
| Q |
338 |
atccataaaggggatccagcaagagttaacattgtgagttcctccatagaaaccacagcaagttctacaatcgttgctttgtcaacttcattaggaattg |
437 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47435802 |
atccataaaggggatccagcaagagttaagattgtgagttcctccatagaaaccacagcaagttctacaatcgttgctttgtcaacttcattaggaattg |
47435901 |
T |
 |
| Q |
438 |
agagggaccctaaggggtcattac |
461 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
47435902 |
agagggaccctaaggggtcattac |
47435925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University