View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9284_low_35 (Length: 379)
Name: NF9284_low_35
Description: NF9284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9284_low_35 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 12 - 379
Target Start/End: Complemental strand, 54620050 - 54619682
Alignment:
| Q |
12 |
cagagacaaaatatgattctaataaattggagacaaagaaatgtctgcccataacactcctttacaccgcatacttagagctatgtattcatcattctgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54620050 |
cagagacaaaatatgattctaataaattggagacaaagaaatgtctgcccataacactcctttacaccgcatacttagagctatgtattcatcattctgt |
54619951 |
T |
|
| Q |
112 |
ggcttagctatcactgtctcaatcaacaccctcttattctgtccccaattggctactttatgatggtccactatccctgctctct-nnnnnnnnntaaca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
54619950 |
ggcttagctatcactgtctcaatcaacaccctcttattctgtccccaattggctactttatgatggtccactatccctgctctctcccccccccctaaca |
54619851 |
T |
|
| Q |
211 |
tgttcagtgttttctttctgctttatcccaactaaatggataaggcttaattgaatcactggtttaaggttcatttggtacatacaaagcgttatgttta |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
54619850 |
tgttcagtgttttctttctgctttatcccaactaaatggataaggcttaattgaatcactggtttaaggttaatttggtacatacaaagtgttatgttta |
54619751 |
T |
|
| Q |
311 |
gtttgacactttgactattattacttctgcaatcatttggatttgaataatgaagacaacccccaagat |
379 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54619750 |
gtgtgacactttgactattattacttctgcaatcatttggatttgaataatgaagacaacccccaagat |
54619682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University