View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9284_low_45 (Length: 257)
Name: NF9284_low_45
Description: NF9284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9284_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 24 - 197
Target Start/End: Complemental strand, 1353627 - 1353454
Alignment:
| Q |
24 |
taaatggtaaaaatcaaaggaaacaagttatatcgaataaatggtaatgagcggtttgaccaaatccggttcaacgttgtagccaacggttcttccacta |
123 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||||| |||||||||||| ||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
1353627 |
taaatggtaaaaatcgaaggaaacaagttataccgaataaatggtaatgagtggtttgaccaaacccgattcaacgttgtagccaacggttcttcctcta |
1353528 |
T |
 |
| Q |
124 |
aattcaaaccggggtttctacatatttaaatctcaattttggtctagatgtgattcttttattgcattgtaaag |
197 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1353527 |
aattcaaaccagggtttctacatatttaaatctcaattttggtctagatgtgattcttttattgcattgtaaag |
1353454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University