View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9286_low_32 (Length: 255)
Name: NF9286_low_32
Description: NF9286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9286_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 24 - 240
Target Start/End: Complemental strand, 4588188 - 4587972
Alignment:
| Q |
24 |
gaggaaaccgtgacacgattcctcttaatcgtgaaatgattggaggaccagtttaaaattcatgactgtttcaaatcaaattgtgacacgatcctctccc |
123 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4588188 |
gaggaaaccgtgacactattcctcttaattgtgaaatgattggaggaccagtttaaaattcttgactgtttcaaatcaaatcgtgacacgatcctctcca |
4588089 |
T |
 |
| Q |
124 |
aatcctgacacgatttccctgcccttcacaactcatttttcagaaattagaaacctactgttactctatcaaatattttcaagacttacaaacccatgaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4588088 |
aatcctgacacgatttccctgcccttcacaactcatttttcagaaattagaaacctactgttactctatcaaatattttccagacttacaaacccatgaa |
4587989 |
T |
 |
| Q |
224 |
attcaacccttttcttc |
240 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
4587988 |
attcaacccttttcttc |
4587972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University