View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9286_low_36 (Length: 236)
Name: NF9286_low_36
Description: NF9286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9286_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 34983098 - 34983274
Alignment:
| Q |
1 |
cgcatatgtcttcaagaagaatattaggttcaacttcagatgatttagctgtcctatttcttggtggtctaatctatcactttatcttggttatgctaat |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34983098 |
cgcatatgtcttcaagaaggatattaggttcaacttcagatgatttagttgtcctatttcttggtggtctaatctgtcactttatcttggttatgctaat |
34983197 |
T |
|
| Q |
101 |
atgtaacgacgaattttggacggttttattctttgtatattgacactttgttttgatccattttaggcacctatcaa |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34983198 |
atgtaacgacgaattttggacggttttattctttgtatattgacactttgttttgatccattttaggcacctatcaa |
34983274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 34983658 - 34983701
Alignment:
| Q |
170 |
cctatcaatgttatcccttatataaatgttttattgtttcttgt |
213 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34983658 |
cctatcaatgttatcccttatataagtgttttattgtttcttgt |
34983701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 118
Target Start/End: Complemental strand, 13058929 - 13058869
Alignment:
| Q |
58 |
ttcttggtggtctaatctatcactttatcttggttatgctaatatgtaacgacgaattttg |
118 |
Q |
| |
|
|||||| |||| ||| ||||||||| ||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
13058929 |
ttcttgatggttcaatatatcactttgtcttgattacgctaatatgtaatgacgaattttg |
13058869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 113 - 166
Target Start/End: Original strand, 29797932 - 29797986
Alignment:
| Q |
113 |
attttggacggttttattctttg-tatattgacactttgttttgatccattttag |
166 |
Q |
| |
|
||||||||| |||||||||||| |||| ||||||||||||||||||| |||||| |
|
|
| T |
29797932 |
attttggacagttttattcttttatatactgacactttgttttgatcccttttag |
29797986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University