View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9286_low_37 (Length: 232)
Name: NF9286_low_37
Description: NF9286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9286_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 1402653 - 1402435
Alignment:
| Q |
1 |
tctcatattgaaatgtcattatcatattaaataccattttcaaaagtcagaaaaagagtaccttaacttgaacatcttagagtggaagctggttaacata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1402653 |
tctcatattgaaatgtcattatcatattaaataccattttcaaaagtcagaaaaagagtaccttaacttgaacatcttagagtggaagctgattaacata |
1402554 |
T |
 |
| Q |
101 |
atagtagatagatcaactattgacagtttagggtattatggattggtggaatgagatggaacggagtagggttatgttctatttttggagtttagagtag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1402553 |
atagtagatagatcaactattgacagtttagggtattatggattggtggaatgagatggaacggagtagggttatgttctatttttggagtttagagtag |
1402454 |
T |
 |
| Q |
201 |
tttttgtctaactcaagta |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1402453 |
tttttgtctaactcaagta |
1402435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University