View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9286_low_38 (Length: 232)

Name: NF9286_low_38
Description: NF9286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9286_low_38
NF9286_low_38
[»] chr3 (1 HSPs)
chr3 (1-219)||(1402435-1402653)


Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 1402653 - 1402435
Alignment:
1 tctcatattgaaatgtcattatcatattaaataccattttcaaaagtcagaaaaagagtaccttaacttgaacatcttagagtggaagctggttaacata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
1402653 tctcatattgaaatgtcattatcatattaaataccattttcaaaagtcagaaaaagagtaccttaacttgaacatcttagagtggaagctgattaacata 1402554  T
101 atagtagatagatcaactattgacagtttagggtattatggattggtggaatgagatggaacggagtagggttatgttctatttttggagtttagagtag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1402553 atagtagatagatcaactattgacagtttagggtattatggattggtggaatgagatggaacggagtagggttatgttctatttttggagtttagagtag 1402454  T
201 tttttgtctaactcaagta 219  Q
    |||||||||||||||||||    
1402453 tttttgtctaactcaagta 1402435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University