View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9287_low_29 (Length: 350)
Name: NF9287_low_29
Description: NF9287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9287_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 31193126 - 31192949
Alignment:
| Q |
1 |
actaaattcttaagtggggtgattgctattctgaatgccactcatcattgcaaaaataagtttgagacagtaccagatgttgatgagaattgaattacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31193126 |
actaaattcttaagtggggtgattgccattctgaatgccactcatcattgcaaaaataagtttgagacagtacaagatgttgatgagaattgaattacat |
31193027 |
T |
 |
| Q |
101 |
ataaggatgaattaagtcgggttgtgactagtttctacaaaaatatattttcagatgaggaagaatttgatcaaattt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31193026 |
ataaggatgaattaagtcgggttgtgactagtttctacaaaaatatattttcagatgaggaagaatttgatcaaattt |
31192949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 176 - 309
Target Start/End: Complemental strand, 31189042 - 31188909
Alignment:
| Q |
176 |
ttttatctatctagaactatccctcagttctcataagtgaaaataaatagttttgctagactgattactcgtggtaaaaaatttcggttcgtatggagga |
275 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31189042 |
ttttatctatctagaactatccctcagctctcataagtgaaaataaatagttttgctaaactgattactcgtggtaaaaaatttcggttcgtatggagga |
31188943 |
T |
 |
| Q |
276 |
tgtaaggctccttgggttgatagtcttcaatccc |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31188942 |
tgtaaggctccttgggttgatagtcttcaatccc |
31188909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University