View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9287_low_37 (Length: 286)
Name: NF9287_low_37
Description: NF9287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9287_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 17 - 245
Target Start/End: Complemental strand, 21121022 - 21120794
Alignment:
| Q |
17 |
actgacaccaaccaacactaacatgccgacaccgataataattcgagaaaatgtcatagctataatacagcaatctaaaataaaatagttaaagttacag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21121022 |
actgacaccaaccaacactaacatgccgacaccgataataattcgagaaaatgtcatagctataatacagcaatctaaaataaaatagttaaagttacag |
21120923 |
T |
 |
| Q |
117 |
ttatggtaccttcttagtacgggttctaatctcggatttacgagctttgttgtaaacgcgacgcctctcagcctgaagagctttcttaatggcggaatca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21120922 |
ttatggtaccttcttagtacgggttctaatctcggatttacgagctttgttgtaaacgcgacgcctctcagcctgaagagctttcttaatggcggaatca |
21120823 |
T |
 |
| Q |
217 |
accttctttggagcagcctcgcaaacaac |
245 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21120822 |
accttctttggagcagcctcgcaaacaac |
21120794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 74
Target Start/End: Complemental strand, 4859186 - 4859142
Alignment:
| Q |
30 |
aacactaacatgccgacaccgataataattcgagaaaatgtcata |
74 |
Q |
| |
|
|||||||||||| ||||||| ||||||||| ||||||||| |||| |
|
|
| T |
4859186 |
aacactaacatgtcgacaccaataataatttgagaaaatgacata |
4859142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University