View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9287_low_38 (Length: 285)
Name: NF9287_low_38
Description: NF9287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9287_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 277
Target Start/End: Original strand, 4424107 - 4424367
Alignment:
| Q |
17 |
actcttcaaattgattcatgtgaaatttattaacctttaaattcaatcacttaattttctctaaattgggtaggtagaattttatgnnnnnnncaaagac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4424107 |
actcttcaaattgattcatgtgaaatttattaacctttaaattcaatcacttaattttctctaaattgggtaggtagaattttatgtttttttcaaagac |
4424206 |
T |
 |
| Q |
117 |
ataaagttgctgcaattttactcaagtattaaaatgtnnnnnnnttataggaaaagattaatcaaaatccaacgttgatgaatgagtgaactaaactagt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4424207 |
ataaagttgctgcaattttactcaagtattaaaatgtaaaaaaattataggaaaagattaatcaaaatccaacgttgatgaatgagtgaactaaactagt |
4424306 |
T |
 |
| Q |
217 |
caatgcatgggcaataatattccgcggagcagaggatcgtcatcaacgtctctgctactcc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4424307 |
caatgcatgggcaataatattccgcggagcagaggatcgtcatcaacgtctctgttactcc |
4424367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University