View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9287_low_52 (Length: 234)
Name: NF9287_low_52
Description: NF9287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9287_low_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 16 - 220
Target Start/End: Original strand, 4497673 - 4497877
Alignment:
| Q |
16 |
caatttcttcaacttttctatgcnnnnnnntgaattttgagaacaagttaactgtgcttgatgtttcaaataacttgttatctggtgatcttggtcactg |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4497673 |
caatttcttcaacttttctatgcaaaaaaatgaattttgagaacaagttaactgtgcttgatgtttcaaataacttgttatctggtgatcttggtcactg |
4497772 |
T |
|
| Q |
116 |
ttggatacattggcaaaatttaatgcacttgaatttaggaagaaacaatttgtctggtgaaattccaaattccatcggttttttatctgaacttgaatct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4497773 |
ttggatacattggcaaaatttaatgcacttgaatttaggaagaaacaatttgtctggtgaaattccaaatcccatcggttttttatctgaacttgaatct |
4497872 |
T |
|
| Q |
216 |
ctgct |
220 |
Q |
| |
|
|||| |
|
|
| T |
4497873 |
ttgct |
4497877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 46 - 220
Target Start/End: Complemental strand, 4330211 - 4330037
Alignment:
| Q |
46 |
tgaattttgagaacaagttaactgtgcttgatgtttcaaataacttgttatctggtgatcttggtcactgttggatacattggcaaaatttaatgcactt |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4330211 |
tgaattttgagaacaagttaactgtgcttgatgtttcaaataacttgttatctggtaatcttggccactgttggattcattggcaaaatttaatgcactt |
4330112 |
T |
|
| Q |
146 |
gaatttaggaagaaacaatttgtctggtgaaattccaaattccatcggttttttatctgaacttgaatctctgct |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |||| |
|
|
| T |
4330111 |
gaatttaggaagaaacaatttgtctggtgaaattccaaactccattggttttttatctgaacttgaatctttgct |
4330037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University