View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_high_9 (Length: 389)
Name: NF9288A_high_9
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 1e-54; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 169 - 312
Target Start/End: Complemental strand, 45643575 - 45643434
Alignment:
| Q |
169 |
gcaattacataaagctaacccattatatctcaattctcaaacaagattctcgtagcctccttgattaaaatggctttctctaatgctttgattttatgct |
268 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45643575 |
gcaattacataaagctaaaccattat--ctcaattctcaaataagatcctcgtagcttccttgattaaaatggctttctctaatgctttggttttatgct |
45643478 |
T |
 |
| Q |
269 |
tctttttagctatcactatggcattgccgactctggcaacaaac |
312 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45643477 |
tctttttagctatcactatgccattgccgactctggcaacaaac |
45643434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 232 - 312
Target Start/End: Original strand, 45702816 - 45702896
Alignment:
| Q |
232 |
attaaaatggctttctctaatgctttgattttatgcttctttttagctatcactatggcattgccgactctggcaacaaac |
312 |
Q |
| |
|
||||||||| | |||| ||| |||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
45702816 |
attaaaatgacattctttaaggctttggttttatgcttctttttagcgatcactatgccattgccgactctggcaacaaac |
45702896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 232 - 312
Target Start/End: Original strand, 45886628 - 45886708
Alignment:
| Q |
232 |
attaaaatggctttctctaatgctttgattttatgcttctttttagctatcactatggcattgccgactctggcaacaaac |
312 |
Q |
| |
|
||||||||| | |||| ||| |||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
45886628 |
attaaaatgacattctttaaggctttggttttatgcttctttttagcgatcactatgccattgccgactctggcaacaaac |
45886708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 244 - 308
Target Start/End: Complemental strand, 45650815 - 45650751
Alignment:
| Q |
244 |
ttctctaatgctttgattttatgcttctttttagctatcactatggcattgccgactctggcaac |
308 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||| |||| | ||||| |||| ||||| ||||| |
|
|
| T |
45650815 |
ttctctaatcctttgattttaggcttctttttagtgatcaatgtggcagtgccaactcttgcaac |
45650751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University