View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_114 (Length: 348)
Name: NF9288A_low_114
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_114 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 1 - 327
Target Start/End: Original strand, 40127392 - 40127718
Alignment:
| Q |
1 |
ggtggtagagctttttaacaccacactcctcatatctttctctccctttccttcattggcctctatcacattccggatctgatccacgacttgggctaat |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40127392 |
ggtggtggagctttttaacaccacactcctcatatctttatctccctttccttcattggcctctatcacattccggatctgatccacgacttgggctaat |
40127491 |
T |
|
| Q |
101 |
cgctctctctcgttgattggcccaggtctggatgcatcctccggatagataatgcatgccactttgtcattatgggtccaggcttttgcagatatgatgt |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40127492 |
cgctctctctcgttgattgggccaggtctggatgcatcctccggatagataatgcataccactttgtcattatgggtccaggcttttgcagatatgatgt |
40127591 |
T |
|
| Q |
201 |
tgaagcccaagtccatcagtaccaccgatatctctgaaaacaagcctggtcgatccgttcctatcacctctatggcaacatttgcttcttgtggtccctt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40127592 |
tgaagcccaagtccatcagtaccaccgatatctctgaaaacaagcctggtcgatccgttcctatcacctctatggcaacatttgcttcttgtggtccctt |
40127691 |
T |
|
| Q |
301 |
gcaacagtgttgcactgtttcacttga |
327 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40127692 |
gcaacagtgttgcactgtttcacttga |
40127718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University