View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_127 (Length: 340)
Name: NF9288A_low_127
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_127 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 16 - 331
Target Start/End: Original strand, 37676630 - 37676951
Alignment:
| Q |
16 |
cttctttcagcaacaataaccgtaataaccaccgtgtcttctttaaagtctcagcttcatcttcatcttcgtttcaagctcttatatttgactgtgacgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37676630 |
cttctttcagcaacaataaccgtaataaccaccgtgtcttctttaaagtctcagcttcatcttcatcttcgtttcaagctcttatatttgactgtgacgg |
37676729 |
T |
|
| Q |
116 |
tgtcatcttggaatctgagcacttacatcgtcaggcttataacgatgcatttcttcacttcaatgttcgttctc------cttcttcttcttctcaacca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37676730 |
tgtcatcttggaatctgagcacttacatcgtcaggcttataacgatgcatttcttcacttcaatgttcgttctccttcttcttcttcttcttctcaacca |
37676829 |
T |
|
| Q |
210 |
ctcaactgggatatagaattctatgatcaacttcagaaccaaattggcggtggcaaacccaaaatgcgatggttccataaatttctttcttttattcttg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37676830 |
ctcaactgggatatagaattctatgatcaacttcagaaccaaattggcggtggcaaacccaaaatgcgatggttccataaatttctttcttttattcttg |
37676929 |
T |
|
| Q |
310 |
aaacattgcttcttagtattat |
331 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37676930 |
aaacattgcttcttagtattat |
37676951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University