View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9288A_low_131 (Length: 338)

Name: NF9288A_low_131
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9288A_low_131
NF9288A_low_131
[»] chr6 (2 HSPs)
chr6 (28-338)||(30850791-30851105)
chr6 (59-88)||(4323836-4323865)
[»] chr8 (1 HSPs)
chr8 (59-95)||(34489285-34489321)
[»] chr7 (1 HSPs)
chr7 (62-97)||(21968862-21968897)
[»] chr5 (1 HSPs)
chr5 (59-95)||(39424572-39424608)


Alignment Details
Target: chr6 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 28 - 338
Target Start/End: Original strand, 30850791 - 30851105
Alignment:
28 ttttaaatagtgataaaagctatctagcaaagacactttagattgaaggtgtgtctggtgtctgacacgttatgggatctaatatcgacacacactgaca 127  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||    
30850791 ttttaaatagtgacaaaagctatctagcaaagacactttagattgaaggtgtgtctcgtgtctgacacgttatggggtctaatatcgacacacactgaca 30850890  T
128 aatgtagttaccattggtgtctaca----tgtcagttgtgtgtcaatgtttgagtatattttagtgcatcggcatacaccgacaaatatagctaccattg 223  Q
    |||||||||||||||||||||||||    |||||||  |||||||||||||||||||||||||||||||| |||||||| ||||||||||| ||||||||    
30850891 aatgtagttaccattggtgtctacatacatgtcagtcctgtgtcaatgtttgagtatattttagtgcatcagcatacactgacaaatatagttaccattg 30850990  T
224 gtgtctacgtgtcagtgttgtgtcaatgtttgagtatgtattaatactttctaaagtcaaagtataagtcttattgaatgtgatgctttggtttcatgtc 323  Q
    |||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30850991 gtgtctacgtgttagtgttgtgtcaatgtttgagtatgtattagtactttctaaagtcaaagtataagtcttattgaatgtgatgctttggtttcatgtc 30851090  T
324 attcctttcggttct 338  Q
    |||||||||||||||    
30851091 attcctttcggttct 30851105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 59 - 88
Target Start/End: Original strand, 4323836 - 4323865
Alignment:
59 gacactttagattgaaggtgtgtctggtgt 88  Q
    ||||||||||||||||||||||||||||||    
4323836 gacactttagattgaaggtgtgtctggtgt 4323865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 59 - 95
Target Start/End: Complemental strand, 34489321 - 34489285
Alignment:
59 gacactttagattgaaggtgtgtctggtgtctgacac 95  Q
    ||||||||||||||||||||||||| |||||||||||    
34489321 gacactttagattgaaggtgtgtctcgtgtctgacac 34489285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 62 - 97
Target Start/End: Complemental strand, 21968897 - 21968862
Alignment:
62 actttagattgaaggtgtgtctggtgtctgacacgt 97  Q
    ||||||||||||||| ||||||||||||||||||||    
21968897 actttagattgaaggcgtgtctggtgtctgacacgt 21968862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 59 - 95
Target Start/End: Complemental strand, 39424608 - 39424572
Alignment:
59 gacactttagattgaaggtgtgtctggtgtctgacac 95  Q
    |||||||||||||| |||||||| |||||||||||||    
39424608 gacactttagattggaggtgtgtttggtgtctgacac 39424572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University