View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_153 (Length: 320)
Name: NF9288A_low_153
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_153 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 96 - 304
Target Start/End: Complemental strand, 32274788 - 32274580
Alignment:
| Q |
96 |
tgttgactcaaatgtctcctataaaaaggacacgagggagtaattgggatctacaaatgcttgctgacatcttttatccaaaacttttctggtagataca |
195 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32274788 |
tgttgactcatatgtctcctataaaaaggacacgagggagtaattgggatctacaaatgcttgctgacatcttttatccaaaacttttctggtagataca |
32274689 |
T |
 |
| Q |
196 |
tctacataaaaggttgcttaattttggttgagtgccaccagtttagaacagatttttacttagggcctttaatttgtgactttcttattgtcactgtgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32274688 |
tctacataaaaggttgcttaattttggttgactgccaccagtttagaacagatttttacttagggcctttaatttgtgactatcttattgtcactgtgat |
32274589 |
T |
 |
| Q |
296 |
aataaaaca |
304 |
Q |
| |
|
||||||||| |
|
|
| T |
32274588 |
aataaaaca |
32274580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University