View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_193 (Length: 288)
Name: NF9288A_low_193
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_193 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 11 - 282
Target Start/End: Original strand, 45531029 - 45531303
Alignment:
| Q |
11 |
cagagatcttgagcttaaattcaaccttac---atctacactttgacaaaataggtgttgttgacgtcaaaacaagaggggagagaagacatattgcacg |
107 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45531029 |
cagagatcttgagctcaaattcaaccttacttgatctacacttttacaaaataggtgttgttgacgtcaaaactagaggggagagaagacatattgcacg |
45531128 |
T |
|
| Q |
108 |
tgcctcactttgaggtttattttattggacaagtgtgatattatgagtcacttgattccatggatttcgcaactatgatttgttgctagttttatgactt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
45531129 |
tgcctcactttgaggtttattttattggacaagtgtgatattatgagtcacttgattccatggatttcacaactatgatttgttgctagtcttatgactt |
45531228 |
T |
|
| Q |
208 |
acacatgatataaccggatcatgactcataaacaataccctcaaggcattctttagtatttctttaattataatt |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45531229 |
acacatgatataaccggatcatgactcataaacaatatcctcaaggcattctttagtatttctttaattataatt |
45531303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University