View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_212 (Length: 280)
Name: NF9288A_low_212
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_212 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 9 - 126
Target Start/End: Complemental strand, 5930310 - 5930193
Alignment:
| Q |
9 |
aatgagatttggctactgtcaaaaatggcagggcaaaaagtaaatcttaacaagaggtggtaaaatctaaaacaacttcctgataagtatgatctcttta |
108 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5930310 |
aatgagatttgtctactgtcaaaaatggcagggcaaaaagtaaatcttaacaagaggtggtaaaatctaaaacaacttcctgataagtatgatctgttta |
5930211 |
T |
|
| Q |
109 |
atgttcttggtaacaatt |
126 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
5930210 |
atgttcctggtaacaatt |
5930193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 130 - 263
Target Start/End: Complemental strand, 5928928 - 5928797
Alignment:
| Q |
130 |
aatgagatttggctactgtcaatcatgagattacnnnnnnngatagcttcatgatattagcacttcaatttttcaatgttccaaatatgtatgatcagaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
5928928 |
aatgagatttggctactgtcaatcatgacattacaaaaac--atagcttcatgatattagcacttctatttttcaatgttccaaatatgtatgatcaaaa |
5928831 |
T |
|
| Q |
230 |
caataattcctaacacaattctatatcaataact |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5928830 |
caataattcctaacacaattctatatcaataact |
5928797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University