View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_214 (Length: 279)
Name: NF9288A_low_214
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_214 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 7 - 259
Target Start/End: Complemental strand, 43541116 - 43540864
Alignment:
| Q |
7 |
tatcatagaattaataatataataacattatccagctagcatgtcttgaatcttgatcaaacaaaattttcccctttaacatgacattttattccnnnnn |
106 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43541116 |
tatcacagaattaataatataataacattatccagctagcatgtcttgaatcttgatcaaacagaattttcccctttaacatgacattttattccaaaaa |
43541017 |
T |
|
| Q |
107 |
nnttaaatagtcttctacaatcttaatatcctaagtttacatatgatattgtggtttgcaagctaaatctacttcctcataactgaaagttaatttttgg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
43541016 |
aaataaatagtcttctacaatcttaatatcctaagtttacatatgatattgtggtttgcaagctatatctacttccacataactgaaagttaatttttgg |
43540917 |
T |
|
| Q |
207 |
tttcaaaagcttctctcgttcaacaaattaatcagcttgctccatggacaatt |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540916 |
tttcaaaagcttctctcgttcaacaaattaatcagcttgctccatggacaatt |
43540864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University