View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_223 (Length: 277)
Name: NF9288A_low_223
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_223 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 58 - 271
Target Start/End: Original strand, 45934582 - 45934795
Alignment:
| Q |
58 |
ctggacagattggaagcggtggatgggaaaccagggtggtattgttattccatctgatcaaagctgggaatcttggtgggatgaagaaaatgaacacctg |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45934582 |
ctggacagattggaagcggtggatgggaaaccagggtggtattggtattccatctgatcaaagctgggaatcttggtgggatgaagaaaatgaacatctg |
45934681 |
T |
|
| Q |
158 |
aaatactccaatgtccgagggaaaatacttgagattgttcttgcatgtcgtttctttatctatcaatatggaatcatctaccacctgaatattgcgcatc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45934682 |
aaatactccaatgtccgagggaaaatacttgagattgtttttgcatgtcgtttctttatctatcaatatggaatcatctaccacctgaatattgcgcatc |
45934781 |
T |
|
| Q |
258 |
gtagcaaaaatatt |
271 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
45934782 |
gtagcaaaaatatt |
45934795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 4 - 57
Target Start/End: Original strand, 45934453 - 45934506
Alignment:
| Q |
4 |
gaataatatcgaagctcgactcttaatttccttatcacaatctcaatgtggttt |
57 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45934453 |
gaatcatatcgaagctcgactcttaatttccttatcacaatctcaatgtggttt |
45934506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 65 - 271
Target Start/End: Original strand, 15816822 - 15817028
Alignment:
| Q |
65 |
gattggaagcggtggatgggaaaccagggtggtattgttattccatctgatcaaagctgggaatcttggtgggatgaagaaaatgaacacctgaaatact |
164 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15816822 |
gattggaagcggtggatgggaaaccgtggtggtattggtattccatctgataaaagctgggaatcttggtgggatgaagaaaatgaacacctgaaatact |
15816921 |
T |
|
| Q |
165 |
ccaatgtccgagggaaaatacttgagattgttcttgcatgtcgtttctttatctatcaatatggaatcatctaccacctgaatattgcgcatcgtagcaa |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
15816922 |
ccaatgtccgagggaaaatacttgagattgttcttgcatgccgcttctttatctaccaatatggaattgtctaccacctgaatattgcgcgtcgtagcaa |
15817021 |
T |
|
| Q |
265 |
aaatatt |
271 |
Q |
| |
|
||||||| |
|
|
| T |
15817022 |
aaatatt |
15817028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 3 - 57
Target Start/End: Original strand, 15816686 - 15816740
Alignment:
| Q |
3 |
cgaataatatcgaagctcgactcttaatttccttatcacaatctcaatgtggttt |
57 |
Q |
| |
|
||||| ||| |||||||| |||||| ||||| | ||||||||||||||||||||| |
|
|
| T |
15816686 |
cgaatcataccgaagctcaactctttatttcttcatcacaatctcaatgtggttt |
15816740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University