View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9288A_low_279 (Length: 259)

Name: NF9288A_low_279
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9288A_low_279
NF9288A_low_279
[»] chr5 (1 HSPs)
chr5 (10-79)||(276275-276344)


Alignment Details
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 10 - 79
Target Start/End: Original strand, 276275 - 276344
Alignment:
10 atatgaatgcatggttcacattaccactagattgtatggtagtaaggaattgatatgtaatggttttcaa 79  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
276275 atatgaatgcatggttcacattaccactagattgtatggtagtaaggaattgatatgtaatggttttcaa 276344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University