View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_282 (Length: 258)
Name: NF9288A_low_282
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_282 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 21 - 258
Target Start/End: Complemental strand, 18260325 - 18260087
Alignment:
| Q |
21 |
agattcccactaatattcctaatccaagtgaagttaaaaatgctattttttatttgaatcatgatggtgcaccagggcctcatgg-tttggtgcttgctt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18260325 |
agattcccactaatattcctaatccaagtgaagttaaaaatgctattttttatttgaatcatgatggtgcaccagggcctcatgggtttggtgcttgctt |
18260226 |
T |
|
| Q |
120 |
tttccaaacctattgggatatagttcagaaagatgtgtatgaagctgtggtagaattcttcaagactggatcgctccttcccaactacaatgcaaactct |
219 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18260225 |
tttccaaacctattggaatatagttaagaaagatgtgtatgaagctgtggtagaattcttcaagactggatggctccttcccaactacaatgcaaactct |
18260126 |
T |
|
| Q |
220 |
cttatcttgatccctaaaactccagatgctaacaccata |
258 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
18260125 |
cttatcttgatccctaaaactccatatgctgacaccata |
18260087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University