View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_286 (Length: 257)
Name: NF9288A_low_286
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_286 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 33063879 - 33064125
Alignment:
| Q |
1 |
aatgagttttagctcgggacggactaactcttataatcattgacaatggccttctttttatnnnnnnnnntgctaatatttgaccatactatatactctc |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
33063879 |
aatgagttttagctcgggacggactgactcttataatcattgacaatggccttctttttattaaaaaaa-tgctaatatttgacaatactatatactctc |
33063977 |
T |
|
| Q |
101 |
agtctttctgatgcatgatgatggttatctataccgttttctaaaaacataacatattaaatcattcattctaactggactgatcttgtacaacagttga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33063978 |
agtctttctgatgcatgatgatggttatctataccgttttctaaaaacataacatattaaatcattcattctaactgaactgatcttgtacaacagttga |
33064077 |
T |
|
| Q |
201 |
tcaaataaatgtccgttaaatactgttcatactgggcatgatattgtt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33064078 |
tcaaataaatgtccgttaaatactgttcatactgggcatgatattgtt |
33064125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University