View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_290 (Length: 256)
Name: NF9288A_low_290
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_290 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 2282007 - 2281765
Alignment:
| Q |
1 |
gaatttagtttgatcaagttgatagagaaaaagattggttagttagttaaatttatgcatcatccatgcatctaacctccaaccctccttaaatcatttt |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2282007 |
gaattgagtttgatcaagttgatagagaaaaagattggttagttagttaaatttatgcatcatccatgcatctaacctcgaaccctccttaaatcatttt |
2281908 |
T |
 |
| Q |
101 |
attaagtttaatttagtactattaatactcaattcataactattcaattgatagaaataatttttatnnnnnnnnnngtgagagaaatatcaatgttctt |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
2281907 |
atcaagtttaatttagtactattaatactcaattcataactattcaattgatagaaataatgtttat-aaaaaaaaagtgagagaaatatcaatgttctt |
2281809 |
T |
 |
| Q |
201 |
cgataagtggtggaggtagtttaatttttagggataaacatatt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2281808 |
cgataagtggtggaggtagtttaatttttagggttaaacatatt |
2281765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University