View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9288A_low_302 (Length: 253)
Name: NF9288A_low_302
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9288A_low_302 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 37601936 - 37601697
Alignment:
| Q |
1 |
taaatctaacaatagtgggatgattcaatgacccaagatttataatctcccattgcacgtgctcatcaatctacaaaaccaaatggaattaaattaaatt |
100 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37601936 |
taaatctaacaatattgggatgcttcaatgacctatgatttataatctccctttgcacgtgctcatcaatctacaaaaccaaatggaattaaattaaatt |
37601837 |
T |
|
| Q |
101 |
taaacatcataaaaggagcacaatgcaaaattcatttatatggagttnnnnnnnnnggaccttaaagcctctttcaatgaacttgacagcatataactcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37601836 |
taaacatcataaaaggagcacaatgcaaaattcatttatatggagttaaaaaaaaaagaccttaaagcctctttcaatgaacttgacagcatataactcg |
37601737 |
T |
|
| Q |
201 |
ccactccatttttcccttataagctttgcaacaccaaagt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37601736 |
ccactccatttttcccttataagctttgcaacaccaaagt |
37601697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 39410721 - 39410650
Alignment:
| Q |
1 |
taaatctaacaatagtgggatgattcaatgacccaagatttataatctcccattgcacgtgctcatcaatct |
72 |
Q |
| |
|
||||||||| ||| ||||||| ||||| |||| | ||||||||||||||| ||| || ||||||||||||| |
|
|
| T |
39410721 |
taaatctaatgatattgggatgcttcaaggacctatgatttataatctccctttgaacatgctcatcaatct |
39410650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University