View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9288A_low_304 (Length: 253)

Name: NF9288A_low_304
Description: NF9288A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9288A_low_304
NF9288A_low_304
[»] chr8 (1 HSPs)
chr8 (1-125)||(35036911-35037035)


Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 35037035 - 35036911
Alignment:
1 gagtgcacaatcttgcgattcattggaattccttgttaagtgggataagtgcatgtaccttgcgcttgcaggcatttctgcatcgactatagctgtgcat 100  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35037035 gagtgcacaattttgcgattcattggaattcctagttaagtgggataagtgcatgtaccttgcgcttgcaggcatttctgcatcgactatagctgtgcat 35036936  T
101 atttgggcaatgttcactatgaatc 125  Q
    |||||||||||||||||||||||||    
35036935 atttgggcaatgttcactatgaatc 35036911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University